inhibin βa  (Proteintech)

Journal: Frontiers in Endocrinology

Article Title: Amelioration of polycystic ovarian morphology by Tokishakuyakusan in a PCOS rat model: association with bone morphogenetic protein 4

doi: 10.3389/fendo.2025.1649124

Figure Lengend Snippet: Bmp4 , Bmp5 , and Inhba expression in the ovaries. (A–C) Relative mRNA expression quantified by real-time PCR. Expression levels are relative to 18S ribosomal RNA. Data are shown as mean ± standard deviation with individual data points. P -values were obtained by one-way analysis of variance (ANOVA) with Tukey’s post hoc test (vehicle: n = 6; DHT: n = 9; DHT+TSS: n = 10). (D–G) Correlation analysis between gene expression and ovarian follicle counts in the DHT and DHT+TSS groups ( n = 6 per group). The correlation coefficient ( r 2 ) and P -value were calculated. DHT, 5α-dihydrotestosterone; TSS, Tokishakuyakusan; Bmp, bone morphogenetic protein; Inhba, inhibin-βa; PCR, polymerase chain reaction.

Article Snippet: Membranes were blocked for 1 h at room temperature with SuperBlock Blocking Buffer in TBS (37535; Thermo Fisher Scientific) and incubated overnight at 4°C with primary antibodies against BMP4 (MAB1049; 1:1,000, Merck Millipore, Burlington, MA, USA) or inhibin βA (17524-1-AP; 1:1,000, Proteintech Group, Inc., Rosemont, IL, USA).

Techniques: Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Gene Expression, Polymerase Chain Reaction

Journal: Frontiers in Endocrinology

Article Title: Amelioration of polycystic ovarian morphology by Tokishakuyakusan in a PCOS rat model: association with bone morphogenetic protein 4

doi: 10.3389/fendo.2025.1649124

Figure Lengend Snippet: BMP4 and inhibin βA protein expression in the ovaries. (A) Representative Western blot images. (B, C) Quantification of BMP4 and inhibin βA protein levels relative to β-actin. Data are shown as mean ± standard deviation with individual data points (vehicle: n = 6; DHT: n = 9; DHT+TSS: n = 10). * P < 0.05, ** P < 0.01, one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test; P < 0.0167 by Bonferroni correction. BMP, bone morphogenetic protein; DHT, 5α-dihydrotestosterone; TSS, Tokishakuyakusan.

Article Snippet: Membranes were blocked for 1 h at room temperature with SuperBlock Blocking Buffer in TBS (37535; Thermo Fisher Scientific) and incubated overnight at 4°C with primary antibodies against BMP4 (MAB1049; 1:1,000, Merck Millipore, Burlington, MA, USA) or inhibin βA (17524-1-AP; 1:1,000, Proteintech Group, Inc., Rosemont, IL, USA).

Techniques: Expressing, Western Blot, Standard Deviation

Journal: Frontiers in Endocrinology

Article Title: Amelioration of polycystic ovarian morphology by Tokishakuyakusan in a PCOS rat model: association with bone morphogenetic protein 4

doi: 10.3389/fendo.2025.1649124

Figure Lengend Snippet: Effect of Tokishakuyakusan (TSS) on target gene expressions in granulosa cells (GCs) derived from prenatally 5α-dihydrotestosterone (DHT)-treated rats. (A) Timeline of ovarian GC collection. (B, C) Relative mRNA expression of Bmp4 and Inhba in primary cultured GCs after 24 h of TSS treatment (125–500 μg/mL). Expression levels are relative to Gapdh . Data are shown as mean ± standard deviation with individual data points ( n = 3 per group). ** P < 0.01, P -values for the untreated control were obtained using one-way analysis of variance (ANOVA) followed by Dunnett’s post hoc test. PMSG, pregnant mare serum gonadotropin; Bmp, bone morphogenetic protein; Inhba, inhibin-βa; Gapdh, glyceraldehyde-3-phosphate dehydrogenase.

Article Snippet: Membranes were blocked for 1 h at room temperature with SuperBlock Blocking Buffer in TBS (37535; Thermo Fisher Scientific) and incubated overnight at 4°C with primary antibodies against BMP4 (MAB1049; 1:1,000, Merck Millipore, Burlington, MA, USA) or inhibin βA (17524-1-AP; 1:1,000, Proteintech Group, Inc., Rosemont, IL, USA).

Techniques: Derivative Assay, Expressing, Cell Culture, Standard Deviation, Control

Journal: Scientific Reports

Article Title: Activin A is deeply involved in the progression of sarcopenia and leads to poor prognosis in lung cancer patients

doi: 10.1038/s41598-025-97907-2

Figure Lengend Snippet: Establishment of LLC cells with shRNA knock-down of activin A expression. ( A ) Experimental scheme of the establishment of activin A knock-down LLC cells using the shRNA strategy. ( B ) Left panels show the mRNA expression bands of inhibin βA and β-actin in control medium, scrambled oligonucleotides, and two sorts of inhibin βA shRNA oligonucleotides (b or c) in LLC cells determined using PCR. The right bar graph shows relative inhibin βA transcript level against control medium mRNA expression determined using PCR ( n = 3) in the four groups. ( C ) Left figure shows the protein expression bands of activin A and β-actin in LLC cells determined using western blot in control medium, scrambled oligonucleotides, and two sorts of inhibin βA shRNA oligonucleotides (b or c) groups. The right bar graph shows the relative activin A protein levels against control medium protein expression determined by measuring the intensities of immunoblot bands ( n = 3) in the four groups. ( D ) Bar graph shows the cell viability of control medium LLC, scramble LLC, and activin A knock-down c LLC determined using MTT assays ( n = 3, each). Data are shown as mean + SD. * P ≤ 0.05 (Student’s t test). ActA activin A, Ctr control, KD knock-down, n.s. not significant.

Article Snippet: The following shRNA oligonucleotides were obtained from Abbexa: inhibin βA (b); GAACGGGTATGTGGAGATAGA, inhibin βA (c); GGAGTGAACTGTTGCTATCAG.

Techniques: shRNA, Knockdown, Expressing, Control, Western Blot

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

doi: 10.1186/1477-7827-8-143

Figure Lengend Snippet: Antibodies used for immunohistochemical characterization of human endometrium

Article Snippet: Inhibin-βA , E4 , Mouse IgG2b , 1:50 , PBS , Serotec, Oxford, UK.

Techniques: Immunohistochemical staining

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

doi: 10.1186/1477-7827-8-143

Figure Lengend Snippet: Primer sequences and length of amplification products

Article Snippet: Inhibin-βA , E4 , Mouse IgG2b , 1:50 , PBS , Serotec, Oxford, UK.

Techniques: Amplification

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

doi: 10.1186/1477-7827-8-143

Figure Lengend Snippet: Immunohistochemical expression of inhibin-βC and -βE in normal liver tissue . Inhibin-βC (Figure 1a; magnification ×400) and βE (Figure 1b; magnification ×400) subunit demonstrated a positive staining reaction in normal human liver tissue.

Article Snippet: Inhibin-βA , E4 , Mouse IgG2b , 1:50 , PBS , Serotec, Oxford, UK.

Techniques: Immunohistochemical staining, Expressing, Staining

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

doi: 10.1186/1477-7827-8-143

Figure Lengend Snippet: Immunohistochemical findings determining localization and intensity of immunostaining intensity for inhibin-α, -βA,- βB, -βC and -βE subunits in human endometrium across the normal menstrual cycle

Article Snippet: Inhibin-βA , E4 , Mouse IgG2b , 1:50 , PBS , Serotec, Oxford, UK.

Techniques: Immunohistochemical staining, Immunostaining

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

doi: 10.1186/1477-7827-8-143

Figure Lengend Snippet: Immunohistochemical expression of inhibin-βC in normal human endometrial tissue . Immunohistochemical staining reaction for inhibin-βC could be observed across the menstrual cycle. Proliferative (Figure 2a, magnification ×250) and early secretory endometria (Figure 2b, magnification ×125) expressed this subunit, but with a weak intensity. The strongest staining intensity could be observed during tissue samples late secretory phase (Figure 2c, magnification ×400). Stromal cells also reacted positively throughout the menstrual cycle.

Article Snippet: Inhibin-βA , E4 , Mouse IgG2b , 1:50 , PBS , Serotec, Oxford, UK.

Techniques: Immunohistochemical staining, Expressing, Staining

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

doi: 10.1186/1477-7827-8-143

Figure Lengend Snippet: Immunohistochemical expression of inhibin-βE in normal human endometrial tissue . Immunohistochemical staining reaction for inhibin-βE could be observed across the menstrual cycle. Proliferative endometrial tissue (Figure 3a, magnification ×250) demonstrated a weak staining intensity, while this intensity increased during early (Figure 3b, magnification ×125) and late secretory endometria. The strongest staining intensity could be observed during tissue samples late secretory phase (Figure 3c, magnification ×400). Stromal cells also reacted positively with a minimal staining intensity in the proliferative phase, being moist prominent during late secretory phase.

Article Snippet: Inhibin-βA , E4 , Mouse IgG2b , 1:50 , PBS , Serotec, Oxford, UK.

Techniques: Immunohistochemical staining, Expressing, Staining

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

doi: 10.1186/1477-7827-8-143

Figure Lengend Snippet: Inhibin/activin-subunit mRNA detection in normal human endometrium tissue . The mRNA of all inhibin/activin-subunits was detected in normal proliferative (Figure 4a) and secretory (Figure 4b) human endometrium using PCR.

Article Snippet: Inhibin-βA , E4 , Mouse IgG2b , 1:50 , PBS , Serotec, Oxford, UK.

Techniques:

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

doi: 10.1186/1477-7827-8-143

Figure Lengend Snippet: Correlation between all five inhibin-subunits

Article Snippet: Inhibin-βA , E4 , Mouse IgG2b , 1:50 , PBS , Serotec, Oxford, UK.

Techniques:

Journal: Reproductive Biology and Endocrinology : RB&E

Article Title: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

doi: 10.1186/1477-7827-8-143

Figure Lengend Snippet: Immunohistochemical score for the expression of all five analyzed inhibin/activin subunits . The immunohistochemical staining reaction for inhibin-α was significantly lower during proliferative compared to late secretory phase. Moreover, the immunohistochemical expression of the inhibin-βA, -βB, and -βE were significantly higher during late secretory compared to proliferative and early secretory phase (*). Inhibin-βC, although being lower during early secretory phase, did not demonstrate any significant changes throughout the menstrual cycle. Values represent means ± SEM. Significance was assumed at p < 0.05 (asterisks).

Article Snippet: Inhibin-βA , E4 , Mouse IgG2b , 1:50 , PBS , Serotec, Oxford, UK.

Techniques: Immunohistochemical staining, Expressing, Staining